User:EvoProgrammer

Human Genome Project

Developer Code Name: EvoProgrammer
project link: https://en.wikipedia.org/wiki/Human_Genome_Project
license link: http://creativecommons.org/licenses/by-nc/4.0/

Python Source Code

def getCodonList():
	a = {}
	a['ATT'] = a['ATC'] = a['ATA'] = 'I'
	a['CTT'] = a['CTC'] = a['CTA'] = a['CTG'] = a['TTA'] = a['TTG'] = 'L'
	a['GTT'] = a['GTC'] = a['GTA'] = a['GTG'] = 'V'
	a['TTT'] = a['TTC'] = 'F'
	a['ATG'] = 'M'
	a['TGT'] = a['TGC'] = 'C'
	a['GCT'] = a['GCC'] = a['GCA'] = a['GCG'] = 'A'
	a['GGT'] = a['GGC'] = a['GGA'] = a['GGG'] = 'G'
	a['CCT'] = a['CCC'] = a['CCA'] = a['CCG'] = 'P'
	a['ACT'] = a['ACC'] = a['ACA'] = a['ACG'] = 'T'
	a['TCT'] = a['TCC'] = a['TCA'] = a['TCG'] = a['AGT'] = a['AGC'] = 'S'
	a['TAT'] = a['TAC'] = 'Y'
	a['TGG'] = 'W'
	a['CAA'] = a['CAG'] = 'Q'
	a['AAT'] = a['AAC'] = 'N'
	a['CAT'] = a['CAC'] = 'H'
	a['GAA'] = a['GAG'] = 'E'
	a['GAT'] = a['GAC'] = 'D'
	a['AAA'] = a['AAG'] = 'K'
	a['CGT'] = a['CGC'] = a['CGA'] = a['CGG'] = a['AGA'] = a['AGG'] = 'R'
	a['TAA'] = a['TAG'] = a['TGA'] = 'stop'
	return a
def getCodon(s):
	return str(getCodonList()[s])
def readDNA(s):
	if len(s) % 3 != 0:
		s = s[0:-(len(s)%3)]
	r = ""
	i = 0
	while i < len(s):
		r = r + getCodon(s[i:i+3])
		i += 3
	return r
	
#programe start
f = open('dna.txt','r+')
for line in f.readlines():
	print(readDNA(line))

File: dna.txt

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGG
GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC
AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG
CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC
TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT
CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA
CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA
CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT
GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

Secure Encryption System (SES) Project

Developer Code Name: EvoProgrammer
license link: http://creativecommons.org/licenses/by-nc/4.0/
Developer GitHub Page: https://github.com/EvoProgrammer/
Project GitHub Page: https://github.com/EvoProgrammer/SecureEncryptionSystem

SES is a secure way of client server communication using the RSA Encryption Scheme packed under the html standard through the use of a self hosted proxy that will contain a public key for the proxying server (external server being connected to, used to do the anonymous proxing) and also a self created RSA key pair (public and private) the first step is to take the server's public key and then encrypt the client's public key with it, send it to the server, now only the server can decrypt any incoming traffic from the client. after that the server will send all traffic back to the client, all data sent back will be encrypted with the public RSA Key that the client sent in the hand shake in the first step.

SES is created solely by "EvoProgrammer" if you would like to work with me or contribute please message me on my fb page thanks... This is still theory, implementation is on the way. link will be posted to github in due time.

this can be laid out as followed:

SES Data Transfer Steps

Handshake
1. Client creates RSA private & public key pair
2. Take the pre-configured server's public key and encrypt client public key with it
3. Send the client's encrypted public key and client's encrypted mac address (address is encrypted with the server's public key) to the server in a TCP/IP datastream connection
4. Server decrypts data, stores the mac address and stores the client's public key with it in a database
Client-Server Data Exchange
1. Client Requests Data From website through the server
2. Server decodes the SESCRD (SES Client Request Data)
3. Server then does what is needed, either post or get data from a server/host requested by the client
Server - Server Data Exchange
1. This server will act as a normal proxy but it is a special one since all data that is sent back is encrypted and is not available to any other devices outside this what you could call a VPN.
2. This server may use SSL to communicate to other servers and the client's browser will be non-the-wiser that this has all taken place, but it has now being secured so even if someone happens to be on your network or if you on an open network then all the session hijacks, SSL attacks and other attacks will be rendered useless.

implementation will be done as followed:

Client Proxy in Java
Server Script in PHP, with the use of MySQL DB

Connection layout

Last Updated/Edit/Modified: EvoProgrammer (talk) 04:20, 17 June 2015 (UTC)