User:DanielCristofani/Hello world program in esoteric languages2
This page shows the hello world program in esoteric programming languages — that is, working programming languages that were designed as experiments or jokes and were not intended for serious use.
\/>>>>>>\+\<<<\+!\>>\+\<<<<\-\<\-!\>>>\+\<<<\-!!+++!\/\-\/>>>>>\+\<<\+\<\+!---!\>>> \+\>\+\<<<\-\<<<\-!\>>>\-!\<<\+\<\+!\>\-\>\-!\>\-!\/\-/>>>>>\+\<<<<<\+!\/\-\/>>>\+\<<\+!
j world!
lpppppppPPPPPPsrfj
Hello, * j
qPh
Note: this actually prints "HI" instead of "Hello, world".
84 > 84 > 84 > 84 > 84 > 84 > 84 > 85
\/
85 < 86 < 86 < 86 < 86 < 86 < 0E < 66
\/ /\
84 > 84 > 0C > 8C > E5 > 0F 84 > 85
\/ /\ \/
85 < 86 < 86 < 3E < 0E 84 > 83 < 86
\/ /\ \/
84 > 84 > 84 > 84 > 84 > 0F 84 > 85
\/
00 < 00 < 00 < B6 < 0E < B6 < 0E < 86
Note: this actually prints "Hi" instead of "Hello, world".
Baa, badassed areas!
Jarheads' arses
queasy nude adverbs!
Dare address abase adder? *bares baser dadas* HA!
Equalize, add bezique, bra emblaze.
He (quezal), aeons liable. Label lilac "bulla," ocean sauce!
Ends, addends,
duodena sounded amends.
"!dlrow olleH">v
:
,
^_@
v v"Hello world!"< > ^ > >:#v_@ ^ .<
define procedure ' 'hello_world' ' [n]:
block 0: begin
print['Hello world!'];
block 0: end.
++++++++++[>+++++++>++++++++++>+++>+<<<<-] >++.>+.+++++++..+++.>++.<<+++++++++++++++. >.+++.------.--------.>+.>.
Hello World Souffle. Ingredients. 72 g haricot beans 101 eggs 108 g lard 111 cups oil 32 zucchinis 119 ml water 114 g red salmon 100 g dijon mustard 33 potatoes Method. Put potatoes into the mixing bowl. Put dijon mustard into the mixing bowl. Put lard into the mixing bowl. Put red salmon into the mixing bowl. Put oil into the mixing bowl. Put water into the mixing bowl. Put zucchinis into the mixing bowl. Put oil into the mixing bowl. Put lard into the mixing bowl. Put lard into the mixing bowl. Put eggs into the mixing bowl. Put haricot beans into the mixing bowl. Liquefy contents of the mixing bowl. Pour contents of the mixing bowl into the baking dish. Serves 1.
AGb-A#A#+A+%A#DF-AC#
when a=0 then put "Hello, world!" set a=1
DNA / Genetic code
[edit]It is possible to treat the standard genetic code as a programming language; the following translates to the peptide HELLQWQRLD.
TACGTACTTAATAATGTTACCGTTGCAAATCTAATC
hello world :-Q S:-P :-Q
No heat: "hello.eta", written by Mike Taylor
** FUNGICIDE **
-- Fungus calendar --
CURTSEY:
Fungal toe! Fungal toe! Fungal hoe!
(Burnt programmer nucleus)
Ooooooo!
CRUDDY 2nd TOE:
Nine(!) fungal hyaena toe5!
Dungy alfalfa, penalty superlunary -- Oh, blubber!
Oo! Oooo! OW!
X"Hello World!"XXSXrRE
H
h();
PLEASE DO ,1 <- #13 DO ,1 SUB #1 <- #238 DO ,1 SUB #2 <- #112 DO ,1 SUB #3 <- #112 DO ,1 SUB #4 <- #0 DO ,1 SUB #5 <- #64 DO ,1 SUB #6 <- #238 DO ,1 SUB #7 <- #26 DO ,1 SUB #8 <- #248 DO ,1 SUB #9 <- #168 DO ,1 SUB #10 <- #24 DO ,1 SUB #11 <- #16 DO ,1 SUB #12 <- #158 DO ,1 SUB #13 <- #52 PLEASE READ OUT ,1 PLEASE GIVE UP
(=<`:9876Z4321UT.-Q+*)M'&%$H"!~}|Bzy?=|{z]KwZY44Eq0/{mlk**hKs_dG5[m_BA{?-Y;;Vb'rR5431M}/.zHGwEDCBA@98\6543W10/.R,+O<
"HELLO, WORLD.!" $$
#0<a>0:0#0>e>0:0#0>f>0>0:0#0^f>0:0#0+4>0:0#0#h>0:0#0^f>0:0#0<g>0:0#0>f >0:0#0<e>0:0#0?4>0:0#0^1>0:0#0>1>0:0^0
A0000159006CA9006C590057A9006F590064A90021000000000000000000000000000000000000 59004809006559006F09002059007209006CFF0000
The following number is a 176-digit program which prints "Hello, world!". You should ignore all newlines.
153609393637869503971282839335995386248921743204830348570033550157913898858976 126298703504031567456769368158187308369080756461086944119139087533415422490572 83074613678144889367
? 'Hello, world!'
!<Hello, world!>
Ook. Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook? Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook? Ook! Ook! Ook? Ook! Ook? Ook. Ook! Ook. Ook. Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook? Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook? Ook! Ook! Ook? Ook! Ook? Ook. Ook. Ook. Ook! Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook. Ook! Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook. Ook. Ook? Ook. Ook? Ook. Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook? Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook? Ook! Ook! Ook? Ook! Ook? Ook. Ook! Ook. Ook. Ook? Ook. Ook? Ook. Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook? Ook? Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook? Ook! Ook! Ook? Ook! Ook? Ook. Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook. Ook? Ook. Ook? Ook. Ook? Ook. Ook? Ook. Ook! Ook. Ook. Ook. Ook. Ook. Ook. Ook. Ook! Ook. Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook. Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook! Ook. Ook. Ook? Ook. Ook? Ook. Ook. Ook! Ook.
d / ("Hello, world!")
0 'd' 'l' 'r' 'o' 'w' ' ' ',' 'o' 'l' 'l' 'e' 'h' s 0 c 0 ret
hello world
forget
come from "hello" print "Hello, " return
come from "world" print "world !" return
\/\ /\ /\ /\
+++ ++ ++ ++
+++ ++ /++++\ ++ ++ /++++\
++\++\++ + + ++ ++ + +
++ +++ +/+++/ ++ ++ + +
++ +++ ++ ++ ++ + +
\/ \/\ /\+++ /\ /\ /++.+/
\ \
/++++.+++++++++++++++++++++++++++ / \
/\ - -#
++ . -.
+ / \++++\ /++++\ ++ /---\- -+
+ /\ + + + + + +. - .- ->
+ +. + + + + +- - +-
. +> + + + + +- - +- -.
\.+/\++/ \++++/ + +\ /-.+/- --
\ / \.</ \ / \/
(Hello World!)r
1 Please porige hot or cold Hello World!
.png?lang=en)
Note: this listing is incomplete, but the pattern is visible.
- - - ..- ...-.---.;newline - - - .-. - ..-.- ...-. ---.;! - - - ...- . . -.---.;d ----. . . -.---.;l ----. . -...---.;r ----. -...---.;o ----...-.- ..-. ---.;W <omitted code for "Hello " is similar to the above for "World!"> -..............;output all characters
0a21646c726f77202c6f6c6c6548
, :::::::::::::::::::::::::::: ,
)
==============================
F
O F
c
=
Hello World!
or
SAS Hello World!
or
AAS Hello
DSA
SAY %~% World
etc.
sidefxio
void main
print 'H
print 'e
print 'l
print 'l
print 'o
print ',
print as char 32
print 'w
print 'o
print 'r
print 'l
print 'd
print '!
G GGG >++++++++++>!+++++++!++++++++++!+++!+##!!!!##-G+G G.+++++++++++++++##!!##.++!.+++..+++++++.+!.++! G G!.+++.------.--------.!+.!.G GG
[ `Hello, _32 `world! _13 _10 ] \15 outs \0 halt
The empty string is a program in Small outputing "Hello World".
; Hello, world in SMITH - version 2 (loop)
; R0 -> index into string (starts at R10)
; R2 -> -1
MOV R0, 10
MOV R2, 0
SUB R2, 1
MOV R[R0], "Hello, world!"
MOV TTY, R[R0]
SUB R0, R2
MOV R1, R0
SUB R1, 23
NOT R1
NOT R1
MUL R1, 8
COR +1, -7, R1
/e+++++++++++++++++++++++++++++.\ ./\/\/\ /+++\!>.+++o.l.+++++++l/ #/?\ $H!\++++++\ + \comma.------------ .<w++++++++.\ /?\<!\-/ /++++++/ +/\ /.--------o/ \-/!.++++++++++/?\n /=\++++++\ +\\!=++++++\ \r+++.l------.d--------.>+.!\-/ \!\/\/\/\/ \++++++++++/
Modular SNUSP:
/@@@@++++# #+++@@\ #-----@@@\n $@\H.@/e.+++++++l.l.+++o.>>++++.< .<@/w.@\o.+++r.++@\l.@\d.>+.@/.# \@@@@=>++++>+++++<<@+++++# #---@@/!=========/!==/
10[?100]11 9[?108]10 13[?101]2 12[?10]0 4[?111]5 8[?114]9 2[?108]3 11[?33]12 6[?87]7 3[?108]4 1[?48]13 5[?32]6 7[?111]8
0101111111110010001111111111010000001101100101001011111110010001111110 1000000110111001010111111100101000101011100101001011111111111001000110 0000000000000000001000000110110000010100000000000000000000000000000000 0000000101001011111111111001000111111101000000110110010100101111110010 0011111101000000110110010101110010100000000000000000000010100000000000 0000000000000000101001011111111111001000110000000000000000000100000011 011000001010
%begin @jump $main %main.0 @echo %msg %main.1 @end %main.count 2 %msg hello world
v#############@
+:DDDDDDDDDDD:[
+#;;;;;;;;;;;#
+
+ ;;
+ >v ;
+ JJ+ >v
+>^-+ J-
+/--+ --
v{>[<;; --
/- + >v; --
+\ +;JJ+>v --
++ +>^++J- --
++ +J++++-;--
++ >^>^++->^-
++ ++-Jv<
>^ >^-+ ;
# v-<+>[ ^
# - ;+
# >-[^
:V+++++;:XVV;:v-----;:xvv;XXXXXXX++.<XXXXXXXXXX+.V ++..+++.<XXX++.>>XV.XX++++.+++.v-.x++.<XXX+++.<X.>
In the House You are inside the small blue house on Pine St. The floor is carpeted and the walls are paneled in a light coloured wood. The door is to the north. Julie is here. >JULIE, Hello, world! Julie doesn't respond. >X JULIE Julie is a twentysomething woman with short brunette hair. >QUIT
`r```````````.H.e.l.l.o. .w.o.r.l.di
Note: actually prints "What do you want, universe?" in Klingon.
~ nuqneH { ~ 'u' ~ nuqneH disp disp } name
nuqneH
Functions:
|| No functions for this program !!
Stuff:
1/Hello is chrs!
1/Sz, 1/Total are all cplx!
Text:
|| Initialize the data !!
Hello < "Hello, world!"!
Size Hello > Sz!
Total < 0!
|| Take the string length and multiply by 100 !!
- Size - 0 Total > Total %10000!
|| Print and delete a character that many times !!
& WORLD < FCHRS (Hello)!
& Hello < - Hello FCHRS (Hello)!
&& %Total!
|| Add a newline !!
WORLD < nl!
:Endtext
1 print("Hello world!");
11001110011100000111110000000100001111100001111110000000001000001100111110000110 00100000100111110001000000000000010011111000001111100010000000000000000010001111 10010000001100001111100011000000000100111110011100111000111000001000111000001111 10000011111001000001111100011001111110000111100000111100000111001111110000111100 01100111000001110001000111110000011111001000001100000001110000011100011111000111 11000111000001000001000011000111110001000001000000011100000111001000111110001111 00000111100001111110000111111000001111000000000000000001111000001110011100001111 00111110001111100011111000001000000000000000000000001111100011100000011100000111 00011100111110001000100000000011100001111100110000000010011111000111100000111100 11110001001110000011111000001111100110011110001000111100000000000100011111001000 00100111100110011100010001111100011000001000111110000111100111001111110001111000 00111100011111000000011110000011100100001111000100011111001100011111000111100000 11100111000110011110010000000000000001111100000111110001001000001110000111110010 00001000111000001110001100111100010011111100011000001111000111110001111000001110 01000011110001001111100000111110000000011110000011110000000000000000111000001110 00001100000110000011100011100000110011111000011111100100111000001111100000110001 1000001001111110000011100110011111000000000111000001110000111100001100
H ************************ ****************** **********
e * * * * * * *
l * *** * ** * * * * *
! o * *** * * * * * * * * *
, * * * ** * * * * * * * *
W * * * * * * * * * * * ** *
r * * * * * * ************ * * * * * * *
d * * * * * * * * ****** * * * * *
* * * * * ** ** * * * * * * *
* ** * * * * * * * ** * *
* * * * * * ** ** * * * * *
* * * * * ** ** * ** * * * *
******************** * * * ** * ** **** *** *
* ** * * ** * ** *
* ** * * * ** * ** *
* ** * ** * ** ** * ** *
***** * ** * * ** ** ** *
** * * ** *
* * *
************************************************************* * *****************************
* * *
* *** * *
* * * * * *
* ** * * * *
* * * * ** ****** * *********************
* * * * * * * * *
* * * * * * * * *
* * * * ** * * * *
* * * * ** * * * *
* * * ***** ** * * * *
* * ** * ** ** * * * *
* * ** * ** ** ***** * * *
* * ** * * ** * * *
* * ** ** * * ** * ** *
* * * ** ***** ** ** * ** *
* * * ** ** * * *
* * ** ** * * *
** * ** * ** *
* * * * *
* * ************************************************************* * * *
** * * * * * *
** * * * * * * *
* * * ************************* ** * * * *
* * * * * * * * * * *
*** * * * * * * * * * * ************** *
* * * * ** * * * * * ** ** * *
* * * * * * *** * * * * ** ** ******* *
** * * * ** * * * * ** * *
* * * * * * * * ** * *
* * * * * * * ** * *
* * * * * * * ** * *
* * * * * * * * ** * *
* * * * * ** * * ** * *
* * * * * * * * * * * *
* * * * * * * * * * * *
* * * * ** * * * * * *
* * * * * * * * * * *
* * * * * * * ** *
* * * * * * * * *
* * * * * * * *
* * * ***** * * *
* * * * * *
* * * * * *
* ** * * *
* * * * *
* * * *
***************************** * *
* *
*********************************************************************************************** *
* *
* *
* ** *
* ** ** *
* ** * *
* ** * *
* ** * *
* ** * *
* ** * ****** *
* **** ** * * * ******************
* * * ** ** ** * *
* * * ** ** * ** *
* * * * * *
* * * * * *
* ***** * * * *
* * * * * *
* * ** * *
* * * * *
* * * *
******* * *
** ** *
** ** * *
** ** * **
************************ ** ** * * *
* ** * * *
* * * * *
* ** * * *
* * * * * *
* * * * * *
* * * ** *
* * ** * *
* * ** *
* * ** *
** ** *
* ** ******************************
** ** **
** ** **
** ** **
** * **
* **
* **
* **
* ** ** **
*************** ** **
**
* ** ** **
*************** ** *
greeting exe HELLO WORLD
<print>Hello World</print>
External links
[edit]- Similar collection on the esolangs wiki
- Hello, World in 4DL
- Hello, World in Shakespeare
- Hello, World in Whitespace
[[Category:Esoteric programming languages|*]] [[he:תוכנית Hello world בשפות איזוטריות]] [[pt:Programa Olá Mundo em linguagens de programação esotéricas]]