Euplotid nuclear code
The euplotid nuclear code (translation table 10) is the genetic code used by Euplotidae.
The code
AAs = FFLLSSSSYY**CCCWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (10) | Standard code (1) | |
|---|---|---|---|---|
| TGA | UGA | Cys (C) | STOP = Ter (*) |
Systematic range
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [2]
- ^ D. C. Hoffman; R. C. Anderson; M. L. DuBois; D. M. Prescott (25 April 1995). "Macronuclear gene-sized molecules of hypotrichs". Nucleic Acids Res. 23 (8): 1279–83. doi:10.1093/nar/23.8.1279. PMC 306850. PMID 7753617.
- ^ Elzanowski, Andrzej; Ostell, Jim; Leipe, Detlef; Soussov, Vladimir. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 19 March 2016.
{{cite web}}: Unknown parameter|name-list-format=ignored (|name-list-style=suggested) (help)