Blepharisma nuclear code
The Blepharisma nuclear code (translation table 15) is a genetic code found in the nuclei of Blepharisma.[1]
Code
AAs = FFLLSSSSYY*QCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (15) | Standard code (1) | |
|---|---|---|---|---|
| TAG | UAG | Gln (Q) | STOP = Ter (*) |
Systematic range and comments
Ciliata: Blepharisma[2]
See also
References
- This article contains public domain text from the NCBI page compiled by Andrzej (Anjay) Elzanowski and Jim Ostell.[3]
- ^ Andrzej Elzanowski; Jim Ostell (26 September 1996). "The Genetic Codes". National Center for Biotechnology Information. Archived from the original on 14 March 2016. Retrieved 20 January 2017.
{{cite web}}: Unknown parameter|deadurl=ignored (|url-status=suggested) (help) - ^ A Liang, K Heckman (1993). "Blepharisma uses UAA as a termination codon". Naturwissenschaften. 80: 225–226. doi:10.1007/bf01175738.
{{cite journal}}: Unknown parameter|last-author-amp=ignored (|name-list-style=suggested) (help) - ^ The Genetic Codes