Chlorophycean mitochondrial code
The chlorophycean mitochondrial code (translation table 16) is a genetic code found in the mitochondria of Chlorophyceae.
Code
AAs = FFLLSSSSYY*LCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (16) | Standard code (1) | |
|---|---|---|---|---|
| TAG | UAG | Leu (L) | STOP = Ter (*) |
Systematic range and comments
Chlorophyceae[1] and the chytridiomycete fungus Spizellomyces punctatus.[2]
See also
References
- This article contains public domain text from the NCBI page compiled by Andrzej (Anjay) Elzanowski and Jim Ostell.[3]
- ^ Y Hayashi-Ishimaru; T Ohama; Y Kawatsu; K Nakamura; S Osawa (June 1996). "UAG is a sense codon in several chlorophycean mitochondria". Current Genetics. 30 (1): 29–33. doi:10.1007/s002940050096. PMID 8662206.
- ^ M. J. Laforest; I. Roewer; B. F. Lang (1 February 1997). "Mitochondrial tRNAs in the lower fungus Spizellomyces punctatus: tRNA editing and UAG 'stop' codons recognized as leucine". Nucleic Acids Research. 25 (3): 626–32. doi:10.1093/nar/25.3.626. PMC 146481. PMID 9016605.
- ^ The Genetic Codes
External links