Jump to content

Subsequence

From Wikipedia, the free encyclopedia
This is an old revision of this page, as edited by Manudouz (talk | contribs) at 11:28, 11 July 2018 (The 'apple' example: removing redundancy and reordering.). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

In mathematics, a subsequence is a sequence that can be derived from another sequence by deleting some or no elements without changing the order of the remaining elements. For example, the sequence is a subsequence of obtained after removal of elements , , and . The relation of one sequence being the subsequence of another is a preorder.

The subsequence should not be confused with substring which can be derived from the above string by deleting substring . The substring is a refinement of the subsequence.

The list of all subsequences for the word "apple" would be "a, ap, al, ae, app, apl, ape, ale, appl, appe, aple, apple, p, pp, pl, pe, ppl, ppe, ple, pple, l, le, e".

Common subsequence

Given two sequences X and Y, a sequence Z is said to be a common subsequence of X and Y, if Z is a subsequence of both X and Y. For example, if

and

then a common subsequence of X and Y could be

This would not be the longest common subsequence, since Z only has length 3, and the common subsequence has length 4. The longest common subsequence of X and Y is .

Applications

Subsequences have applications to computer science,[1] especially in the discipline of bioinformatics, where computers are used to compare, analyze, and store DNA, RNA, and protein sequences.

Take two sequences of DNA containing 37 elements, say:

SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA

The longest common subsequence of sequences 1 and 2 is:

LCS(SEQ1,SEQ2) = CGTTCGGCTATGCTTCTACTTATTCTA

This can be illustrated by highlighting the 27 elements of the longest common subsequence into the initial sequences:

SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA

Another way to show this is to align the two sequences, i.e., to position elements of the longest common subsequence in a same column (indicated by the vertical bar) and to introduce a special character (here, a dash) in one sequence when two elements in the same column differ:

SEQ1 = ACGGTGTCGTGCTAT-G--C-TGATGCTGA--CT-T-ATATG-CTA-
        | || ||| ||||| |  | |  | || |  || | || |  |||
SEQ2 = -C-GT-TCG-GCTATCGTACGT--T-CT-ATTCTATGAT-T-TCTAA

Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.

Theorems

See also

Notes

  1. ^ In computer science, string is often used as a synonym for sequence, but it is important to note that substring and subsequence are not synonyms. Substrings are consecutive parts of a string, while subsequences need not be. This means that a substring of a string is always a subsequence of the string, but a subsequence of a string is not always a substring of the string, see: Gusfield, Dan (1999) [1997]. Algorithms on Strings, Trees and Sequences: Computer Science and Computational Biology. USA: Cambridge University Press. p. 4. ISBN 0-521-58519-8.

This article incorporates material from subsequence on PlanetMath, which is licensed under the Creative Commons Attribution/Share-Alike License.