Jump to content

Blastocrithidia nuclear code

Add links
From Wikipedia, the free encyclopedia
This is an old revision of this page, as edited by Manudouz (talk | contribs) at 19:09, 23 January 2017 (Adding the code 31.). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

The Blastocrithidia nuclear code (translation table 31) is a genetic code used by the nuclear genome of the trypanosomatid Blastocrithidia.[1]

The code (31)

   AAs = FFLLSSSSYYEECCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = ----------**-----------------------M----------------------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).

  1. ^ Záhonová, Kristína; Kostygov, Alexei Y.; Ševčíková, Tereza; Yurchenko, Vyacheslav; Eliáš, Marek. "An Unprecedented Non-canonical Nuclear Genetic Code with All Three Termination Codons Reassigned as Sense Codons". Current Biology. 26 (17): 2364–2369. doi:10.1016/j.cub.2016.06.064.
Retrieved from "https://en.wikipedia.org/w/index.php?title=Blastocrithidia_nuclear_code&oldid=761582259"