Jump to content

Mesodinium nuclear code

Add links
From Wikipedia, the free encyclopedia
This is an old revision of this page, as edited by Manudouz (talk | contribs) at 21:17, 20 January 2017 (Adding section on the code 29.). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

The Mesodinium nuclear code (translation table 29) is a genetic code used by the nuclear genome of the ciliates Mesodinium and Myrionecta.[1]

The code (29)

   AAs = FFLLSSSSYYYYCC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = --------------*--------------------M----------------------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).

  1. ^ Heaphy, Stephen M.; Mariotti, Marco; Gladyshev, Vadim N.; Atkins, John F.; Baranov, Pavel V. (2016-11-01). "Novel Ciliate Genetic Code Variants Including the Reassignment of All Three Stop Codons to Sense Codons in Condylostoma magnum". Molecular Biology and Evolution. 33 (11): 2885–2889. doi:10.1093/molbev/msw166. ISSN 0737-4038. PMC 5062323. PMID 27501944.
Retrieved from "https://en.wikipedia.org/w/index.php?title=Mesodinium_nuclear_code&oldid=761094555"