Human identical sequence
 | This article needs attention from an expert in Viruses. Please add a reason or a talk parameter to this template to explain the issue with the article. |
Human identical sequence (HIS) is RNA elements of 24-27nt length in coronavirus genomes shared sequence similarity within human genome.[1] In pathogenic progression, HIS act as a NamiRNAs (nuclear activating miRNAs) through NamiRNA-enhancer network activates the neighboring host genes.[2][3] The first HIS elements identified in SARS-CoV-2 genome, which have five HIS elements, other human coronavirus have one to five.[1] These sequences are highly conserved in primates, so the concept could be extended to Host identical sequence.[1]
SARS-CoV-2
| name | lenth | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-SARS2-1 | 26 | UGUCUAUGCUAAUGGAGGUAAAGGCU | 7570-7595 in ORF1a | Chr3: 124017420-124017395 | KALRN | |
| HIS-SARS2-2 | 24 | UAUAACACAUATAAAAAUACGUGU | 12494-12517 in ORF1a | Chr3: 176597319-176597342 | ||
| HIS-SARS2-3 | 24 | UUAUAUGCCUUAUUUCUUUACUUU | 6766-6789 in ORF1a | Chr5: 28949255-28949232 | ||
| HIS-SARS2-4 | 27 | AGGAGAAUGACAAAAAAAAAAAAAAAA | 29860-29886 in 3' UTR | Chr18: 73670168-73670142 | FBXO15, TIMM21, CYB5A | same as HIS-SARS1-2 |
| HIS-SARS2-5 | 24 | UUGUUGCUGCUAUUUUCUAUUUAA | 8610-8633 in ORF1a | ChrX: 99693480-99693457 |
SARS-CoV-1
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-SARS-1 | 25 | UAACAUGCUUAGGAUAAUGGCCUCU | 15251-15275 in ORF1b | Chr4: 172887105-172887129 Chr8: 122356667-122356690 |
HAS2, ZHX2 | |
| HIS-SARS-2 | 27 | AGGAGAAUGACAAAAAAAAAAAAAAAA | 29717-29743 in 3' UTR | Chr18: 73670168-73670142 | same as HIS-SARS2-4 |
MERS-CoV
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-MERS-1 | 24 | UUCCAUUUGCACAGAGUAUCUUUU | 24364-24387 in S | ChrX: 25635779-25635802 |
HCoV-HKU1
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-HKU1-1 | 24 | UUAGAAUUGUUCAAAUGUUAUCUG | 18656-18679 | chr1:106816197-106816220 | ||
| HIS-HKU1-2 | 24 | UUUUCUAAGAAAGAUUGGUAUGAU | 14044-14067 | chr1:226438633-226438656 chr4:151100495-151100518 chr5:79284823-79284846 chr5:111192947-111192970 chr7:94695722-94695745 chr7:98386489-98386512 chr15:59768424-59768447 chr22:30137367-30137390 |
||
| HIS-HKU1-3 | 24 | AUUUGACUUUAAAUCUUCAUACUA | 26693-26716 | chr4:11718458-11718481 | ||
| HIS-HKU1-4 | 24 | GAUUGGUUGUAUUUUCAUUUUUAU | 23527-23550 | chr4:33759646-33759669 | ||
| HIS-HKU1-5 | 24 | UAGAUACUGUUAUUUUUAAAAAUA | 19844-19867 | chrX:81711130-81711153 |
HCoV-NL63
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-NL63-1 | 24 | UUAUGAUUUUGGUGAUUUUGUUGU | 13044-13067 | chr1:215311768-215311791 | ||
| HIS-NL63-2 | 24 | GGUGUUUUUGUUGAUGAUGUUGUU | 14920-14943 | chr4:28254452-28254475 | ||
| HIS-NL63-3 | 24 | AUAGGCUUAAAUGCUUCUGUUACU | 20754-20777 | chr6:30469931-30469954 | ||
| HIS-NL63-4 | 24 | AAGUAAUUGUAUUAAGAUGUUAUC | 12124-12147 | chr7:19853545-19853568 | ||
| HIS-NL63-5 | 24 | AACUUUUAUGAUUUUGGUGAUUUU | 13039-13062 | chr9:1525276-1525299 |
HCoV-OC43
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-OC43-1 | 24 | UACAGCUCUUUGUAAAUCUGGUAG | 22827-22850 | chr8:122471006-122471029 | ||
| HIS-OC43-2 | 24 | UUGUAUGAGUGAUUUUAUGAGUGA | 24509-24532 | chr13:30510223-30510246 |
HCoV-229E
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note |
|---|---|---|---|---|---|---|
| HIS-229E-1 | 24 | AAUAUUUUAACAGUACCACGUUAU | 19817-19840 | chr8:42865576-42865599 | ||
| HIS-229E-2 | 24 | ACUUUGUAUUGUGUCCUCCUGGAA | 13139-13162 | chr11:112451251-112451274 |
References
- ^ a b c Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". EBioMedicine. 76: 103861. doi:10.1016/j.ebiom.2022.103861. PMID 35124429.
- ^ Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M; Tong, Y; Chen, L; Ru, D; Zhang, T; Zhou, K; Zhang, B; Xu, P; Yang, Z; Li, W; Song, Y; Xu, J; Zhu, T; Shan, F; Yu, W; Lu, H (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression". Signal transduction and targeted therapy. 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMID 35304437.
- ^ Xiao M, Li J, Li W, Wang Y, Wu F, Xi Y, Zhang L, Ding C, Luo H, Li Y, Peng L, Zhao L, Peng S, Xiao Y, Dong S, Cao J, Yu W (October 2017). "MicroRNAs activate gene transcription epigenetically as an enhancer trigger". RNA Biology. 14 (10): 1326–1334. doi:10.1080/15476286.2015.1112487. PMC 5711461. PMID 26853707.
 | This genetics article is a stub. You can help Wikipedia by expanding it. |