Jump to content

Human identical sequence

From Wikipedia, the free encyclopedia
This is an old revision of this page, as edited by Htmlzycq (talk | contribs) at 02:33, 21 March 2022 (Htmlzycq moved page Draft:Human identical sequence to Human identical sequence). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

Human identical sequence (HIS) is RNA elements of 24-27nt length in coronavirus genomes shared sequence similarity within human genome,[1] act as NamiRNAs (nuclear activating miRNAs) in viral progression.[2] The first HIS elements identified in SARS-CoV-2 genome, which have five HIS elements, other human coronavirus have one to five.[1]

SARS-CoV-2

name lenth sequence location in virus genome location in human genome neighboring genes note
HIS-SARS2-1 26 UGUCUAUGCUAAUGGAGGUAAAGGCU 7570-7595 Chr3: 124017420-124017395 KALRN
HIS-SARS2-2 24 UAUAACACAUATAAAAAUACGUGU 12494-12517 Chr3: 176597319-176597342
HIS-SARS2-3 24 UUAUAUGCCUUAUUUCUUUACUUU 6766-6789 Chr5: 28949255-28949232
HIS-SARS2-4 27 AGGAGAAUGACAAAAAAAAAAAAAAAA 29860-29886 Chr18: 73670168-73670142 FBXO15, TIMM21, CYB5A same as HIS-SARS1-2
HIS-SARS2-5 24 UUGUUGCUGCUAUUUUCUAUUUAA 8610-8633 ChrX: 99693480-99693457

SARS-CoV-1

name length sequence location in virus genome location in human genome neighboring genes note
HIS-SARS-1 25 UAACAUGCUUAGGAUAAUGGCCUCU 15251-15275 Chr4: 172887105-172887129
Chr8: 122356667-122356690
HAS2, ZHX2
HIS-SARS-2 27 AGGAGAAUGACAAAAAAAAAAAAAAAA 29717-29743 Chr18: 73670168-73670142 same as HIS-SARS2-4

MERS-CoV

name length sequence location in virus genome location in human genome neighboring genes note
HIS-MERS-1 24 UUCCAUUUGCACAGAGUAUCUUUU 24364-24387 ChrX: 25635779-25635802

HCoV-HKU1

HCoV-NL63

HCoV-OC43

name length sequence location in virus genome location in human genome neighboring genes note
HIS-OC43-1 24 UACAGCUCUUUGUAAAUCUGGUAG 22827-22850 chr8:122471006-122471029
HIS-OC43-2 24 UUGUAUGAGUGAUUUUAUGAGUGA 24509-24532 chr13:30510223-30510246

HCoV-229E

name length sequence location in virus genome location in human genome neighboring genes note
HIS-229E-1 24 AAUAUUUUAACAGUACCACGUUAU 19817-19840 chr8:42865576-42865599
HIS-229E-2 24 ACUUUGUAUUGUGUCCUCCUGGAA 13139-13162 chr11:112451251-112451274

References

  1. ^ a b Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". EBioMedicine. 76: 103861. doi:10.1016/j.ebiom.2022.103861. PMID 35124429.
  2. ^ Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M; Tong, Y; Chen, L; Ru, D; Zhang, T; Zhou, K; Zhang, B; Xu, P; Yang, Z; Li, W; Song, Y; Xu, J; Zhu, T; Shan, F; Yu, W; Lu, H (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression". Signal transduction and targeted therapy. 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMID 35304437.