Human identical sequence
Appearance
Human identical sequence (HIS) is RNA elements of 24-27nt length in coronavirus genomes shared sequence similarity within human genome,[1] act as NamiRNAs (nuclear activating miRNAs) in viral progression.[2] The first HIS elements identified in SARS-CoV-2 genome, which have five HIS elements.[1]
SARS-CoV-2
name | sequence | location in virus genome | location in human genome | neighboring genes |
---|---|---|---|---|
HIS-SARS2-1 | UGUCUAUGCUAAUGGAGGUAAAGGCU | 7570-7595 | Chr3: 124017420-124017395 | KALRN |
References
- ^ a b Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". EBioMedicine. 76: 103861. doi:10.1016/j.ebiom.2022.103861. PMID 35124429.
- ^ Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M; Tong, Y; Chen, L; Ru, D; Zhang, T; Zhou, K; Zhang, B; Xu, P; Yang, Z; Li, W; Song, Y; Xu, J; Zhu, T; Shan, F; Yu, W; Lu, H (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression". Signal transduction and targeted therapy. 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMID 35304437.