Jump to content

Human identical sequence

From Wikipedia, the free encyclopedia
This is an old revision of this page, as edited by Htmlzycq (talk | contribs) at 06:39, 20 March 2022 (References). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

Human identical sequence is the sequence similarity between coronavirus genomes and human genomes, .[1] .[2]

SARS-CoV-2

name sequence location in virus genome location in human genome neighboring genes
HIS-SARS2-1 UGUCUAUGCUAAUGGAGGUAAAGGCU 7570-7595 Chr3: 124017420-124017395 KALRN

References

  1. ^ Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". EBioMedicine. 76: 103861. doi:10.1016/j.ebiom.2022.103861. PMID 35124429.
  2. ^ Li, Wei; Yang, Shuai; Xu, Peng; Zhang, Dapeng; Tong, Ying; Chen, Lu; Jia, Ben; Li, Ang; Lian, Cheng; Ru, Daoping; Zhang, Baolong; Liu, Mengxing; Chen, Cancan; Fu, Weihui; Yuan, Songhua; Gu, Chenjian; Wang, Lu; Li, Wenxuan; Liang, Ying; Yang, Zhicong; Ren, Xiaoguang; Wang, Shaoxuan; Zhang, Xiaoyan; Song, Yuanlin; Xie, Youhua; Lu, Hongzhou; Xu, Jianqing; Wang, Hailin; Yu, Wenqiang (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". eBioMedicine. 76: 103861. doi:10.1016/j.ebiom.2022.103861. PMID 35304437.